Fundamentholfundamenthol
NEET2024

NEET 2024

180 questions with step-by-step solutions. All free.

Physics

  1. Q1 The moment of inertia of a thin rod about an axis passing through its mid point and perpendicular to the rod is 2400 g cm. The length of the 400 g rod is nearly: …
  2. Q2 A bob is whirled in a horizontal plane by means of a string with an initial speed of rpm. The tension in the string is . If speed becomes while keeping the same radius, the tension in the string becomes: …
  3. Q3A thermodynamic system is taken through the cycle abcda. The work done by the gas along the path bc is:
  4. Q4 In the nuclear emission stated above, the mass number and atomic number of the product respectively, are:
  5. Q5An unpolarised light beam strikes a glass surface at Brewster's angle. Then
  6. Q6 If is the velocity of light in free space, the correct statements about photon among the following are: (A) The energy of a photon is . (B) The velocity of a photon is . (C…
  7. Q7 Two bodies and of same mass undergo completely inelastic one dimensional collision. The body moves with velocity
  8. Q8 A light ray enters through a right angled prism at point P with the angle of incidence as shown in figure. It travels through the prism parallel to its base BC and emerges along the face AC. The refractive index of the prism is: …
  9. Q9 If
  10. Q10 At any instant of time , the displacement of any particle is given by (SI unit) under the influence of force of 5 N. The value of instantaneous power is (in SI unit): …
  11. Q11 A tightly wound 100 turns coil of radius 10 cm carries a current of 7 A. The magnitude of the magnetic field at the centre of the coil is (Take permeability of free space as
  12. Q12A particle moving with uniform speed in a circular path maintains:
  13. Q13A logic circuit provides the output as per the following truth table: The expression for the output is:
  14. Q14 Consider the following statements A and B and identify the correct answer: A. For a solar-cell the I-V characteristics lies in the (IV) quadrant of the given graph. B. In a reverse biased p-n junction diode, the current measured in (A), is due to majority charge carriers. …
  15. Q15In an ideal transformer, the turns ratio is . The ratio is equal to (the symbols carry their usual meaning):
  16. Q16 A wheel of a bullock cart is rolling on a level road as shown in the figure below. If its linear speed is in the direction shown, which one of the following options is correct ( and are any highest and lowest points on the wheel, respectively)? …
  17. Q17If the monochromatic source in Young's double slit experiment is replaced by white light, then
  18. Q18 In the diagram, a strong bar magnet is moving towards solenoid-2 from solenoid-1. The direction of induced current in solenoid-1 and that in solenoid-2, respectively, are through the directions: …
  19. Q19 In a vernier calipers, divisions of vernier scale coincide with divisions of main scale. If 1 MSD represents 0.1 mm, the vernier constant (in cm) is: …
  20. Q20 The output of the given logic gate is similar to the output of an/a: or a solar-cell the I-V characteristics lies in the (IV) quadrant of the given graph.…
  21. Q21 Given below are two statements: one is labelled as Assertion (A) and the other is labelled as Reason (R). Assertion (A): The potential () at any axial point, at 2 m distance () from the centre of the dipole of dipole moment vector
  22. Q22 In a uniform magnetic field of 0.049 T, a magnetic needle performs 20 complete oscillations in 5 seconds as shown. The moment of inertia of the needle is kgm…
  23. Q23Match List-I with List-II: Choose the correct answer from the options given below:
  24. Q24 A horizontal force 10 N is applied to a block A as shown in figure. The mass of blocks A and B are 2 kg and 3 kg, respectively. The blocks slide over a frictionless surface. The force exerted by block A on block B is: …
  25. Q25 Given below are two statements: Statement I: Atoms are electrically neutral as they contain equal number of positive and negative charges. Statement II: Atoms of each element are stable and emit their characteristic spectrum. In the light of the above statements, choose the most appropriate answer from the options given below: …
  26. Q26 The terminal voltage of the battery, whose emf is 10 V and internal resistance 1, when connected through an external resistance of 4 as shown in the figure is: …
  27. Q27 A wire of length '' and resistance 100 is divided into 10 equal parts. The first 5 parts are connected in series while the next 5 parts are connected in parallel. The two combinations are again connected in series. The resistance of this final combination is: …
  28. Q28 The maximum elongation of a steel wire of 1 m length if the elastic limit of steel and its Young's modulus, respectively, are Nm
  29. Q29 A thin flat circular disc of radius 4.5 cm is placed gently over the surface of water. If surface tension of water is Nm, then the excess force required to take it away from the surface is: …
  30. Q30Match List I with List II. Choose the correct answer from the options given below:
  31. Q31In the following circuit, the equivalent capacitance between terminal A and terminal B is:
  32. Q32 The mass of a planet is th that of the earth and its diameter is half that of the earth. The acceleration due to gravity on that planet is:…
  33. Q33The graph which shows the variation of and its kinetic energy, is (where is de Broglie wavelength of a free particle):
  34. Q34The quantities which have the same dimensions as those of solid angle are:
  35. Q35 A thin spherical shell is charged by some source. The potential difference between the two points and (in V) shown in the figure is: (Take
  36. Q36 The following graph represents the curves of an ideal gas (where is the temperature and the volume) at three pressures …
  37. Q37The property which is not of an electromagnetic wave travelling in free space is that:
  38. Q38 A small telescope has an objective of focal length 140 cm and an eye piece of focal length 5.0 cm. The magnifying power of telescope for viewing a distant object? …
  39. Q39 A parallel plate capacitor is charged by connecting it to a battery through a resistor. If is the current in the circuit, then in the gap between the plates: …
  40. Q40 A metallic bar of Young's modulus, Nm
  41. Q41 Two heaters A and B have power rating of 1 kW and 2 kW, respectively. Those two are first connected in series and then in parallel to a fixed power source. The ratio of power outputs for these two cases is: …
  42. Q42Choose the correct circuit which can achieve the bridge balance.
  43. Q43 If the mass of the bob in a simple pendulum is increased to thrice its original mass and its length is made half its original length, then the new time period of oscillation is
  44. Q44 If the plates of a parallel plate capacitor connected to a battery are moved close to each other, then A. the charge stored in it increases. B. the energy stored in it decreases. C. its capacitance increases. D. the ratio of charge to its potential remains the same. E. the product of charge and voltage increases. Choose the most appropriate answer from the options given below: …
  45. Q45 The minimum energy required to launch a satellite of mass from the surface of earth of mass and radius in a circular orbit at an altitude of from the surface of the earth is: …

Chemistry

  1. Q1Match List - I with List - II: Choose the correct answer from the options given below:
  2. Q2Match List - I with List - II: Choose the correct answer from the options given below:
  3. Q3The most stable carbocation among the following is:
  4. Q4 On heating, some solid substances change from solid to vapour state without passing through liquid state. The technique used for the purification of such solid substances based on the above principle is known as …
  5. Q5Match List - I with List - II: Choose the correct answer from the options given below:
  6. Q6Intramolecular hydrogen bonding is present in
  7. Q7The highest number of helium atoms is in
  8. Q8 For the reaction ,
  9. Q9The value for the couple is more positive than that of or due to change of:
  10. Q10Fehling's solution 'A' is
  11. Q11Match List - I with List - II: Choose the correct answer from the options given below:
  12. Q12 Given below are two statements: Statement I: Both
  13. Q13Among group 16 elements, which one does NOT show oxidation state
  14. Q14Which plot of vs is consistent with Arrhenius equation?
  15. Q15 Arrange the following elements in increasing order of electronegativity: N, O, F, C, Si Choose the correct answer from the options given below …
  16. Q16 Given below are two statements: Statement I: The boiling point of three isomeric pentanes follows the order -pentane isopentane neopentane. Statement II: When branching increases, the molecule attains a shape of sphere. This results in smaller surface area for contact, due to which the intermolecular forces between the spherical molecules are weak thereby lowering the boiling point. In the light of the above statements, choose the most appropriate answer from …
  17. Q17Which reaction is NOT a redox reaction?
  18. Q18 Arrange the following elements in increasing order of first ionization enthalpy: Li, Be, B, C, N Choose the correct answer from the options given below: …
  19. Q19Which one of the following alcohols reacts instantaneously with Lucas reagent?
  20. Q20Match List - I with List - II: Choose the correct answer from the options given below:
  21. Q21 Given below are two statements: Statement I: The boiling point of hydrides of Group 16 elements follow the order HO H
  22. Q22 Given below are two statements: Statement I: Aniline does not undergo Friedel-Crafts alkylation reaction. Statement II: Aniline cannot be prepared through Gabriel synthesis. In the light of the above statements, choose the correct answer from the options given below: …
  23. Q23Match List - I with List - II: Choose the correct answer from the options given below:
  24. Q24In which of the following equilibria, and are NOT equal?
  25. Q25 The Henry's law constant () values of three gases (A, B, C) in water are 145,
  26. Q26Identify the correct reagents that would bring about the following transformation:
  27. Q27The compound that will undergo S1 reaction with the fastest rate is:
  28. Q28The energy of an electron in the ground state () for He ion is J, then that for an electron in state for Be ion in J is:
  29. Q29A compound with a molecular formula of CH has two tertiary carbons. Its IUPAC name is:
  30. Q30 The reagents with which glucose does not react to give the corresponding tests/products are A. Tollen's reagent B. Schiff's reagent C. HCN D. NHOH E. NaHSO
  31. Q31 'Spin only' magnetic moment same for which of the following ions? A. Ti B. Cr
  32. Q32Match List-I with List - II: Choose the correct answer from the options given below:
  33. Q331 gram of sodium hydroxide was treated with 25 mL of 0.75 M HCl solution, the mass of sodium hydroxide left unreacted is equal to
  34. Q34 In which of the following processes entropy increases? A. A liquid evaporates to vapour. B. Temperature of a crystalline solid lowered from 130 K to 0 K. C. 2 NaHCO(s) Na
  35. Q35Activation energy of any chemical reactions can be calculated if one knows the value of
  36. Q36Major products A and B formed in the following reaction sequence, are:
  37. Q37 The work done during reversible isothermal expansion of one mole of hydrogen gas at 25C from pressure of 20 atmosphere to 10 atmosphere is: (Given
  38. Q38 Consider the following reaction in a sealed vessel at equilibrium with concentrations of N
  39. Q39For the given reaction:
  40. Q40The pair of lanthanoid ions which are diamagnetic is
  41. Q41 Identify the major product C formed in the following reaction sequence: CH-CH
  42. Q42The products A and B obtained in the following reactions, respectively, are:
  43. Q43 Given below are certain cations. Using inorganic qualitative analysis, arrange them in increasing group number from 0 to VI. A. Al B. Cu
  44. Q44 A compound X contains 32 % of A, 20% of B and remaining percentage of C. Then, the empirical formula of X is: (Given atomic masses of A = 64; B = 40; C = 32) …
  45. Q45 The rate of a reaction quadruples when temperature changes from 27C to 57…

Biology

  1. Q1In the given figure, which component has thin outer walls and highly thickened inner walls?
  2. Q2A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and downstream end:
  3. Q3The equation of Verhulst-Pearl logistic growth is From this equation, K indicates:
  4. Q4Identify the part of the seed from the given figure which is destined to form root when the seed germinates.
  5. Q5Inhibition of Succinic dehydrogenase enzyme by malonate is a classical example of:
  6. Q6A pink flowered Snapdragon plant was crossed with a red flowered Snapdragon plant. What type of phenotype/s is/are expected in the progeny?
  7. Q7 The type of conservation in which the threatened species are taken out from their natural habitat and placed in special setting where they can be protected and given special care is called: …
  8. Q8 These are regarded as major causes of biodiversity loss: A. Over exploitation
    B. Co-extinction
    C. Mutation
    D. Habitat loss and fragmentation
    E. Migration Choose the correct option: …
  9. Q9 Which of the following are required for the dark reaction of photosynthesis? A. Light    B. Chlorophyll    C. CO    D. ATP    E. NADPH …
  10. Q10Bulliform cells are responsible for:
  11. Q11 Identify the type of flowers based on the position of calyx, corolla and androecium with respect to the ovary from the given figures (a) and (b). …
  12. Q12Which one of the following is not a criterion for classification of fungi?
  13. Q13Hind II always cuts DNA molecules at a particular point called recognition sequence and it consists of:
  14. Q14Auxin is used by gardeners to prepare weed-free lawns. But no damage is caused to grass as auxin:
  15. Q15Match List I with List II: Choose the correct answer from the options given below:
  16. Q16Spindle fibers attach to kinetochores of chromosomes during:
  17. Q17Match List I with List II: Choose the correct answer from the options given below:
  18. Q18 Which one of the following can be explained on the basis of Mendel's Law of Dominance? A. Out of one pair of factors one is dominant and the other is recessive.
    B. Alleles do not show any expression and both the characters appear as such in F generation.
    C. Factors occur in pairs in normal diploid plants.
    D. The discrete unit controlling a particular character is called factor.
    E. The expression of only one of the parental …
  19. Q19 What is the fate of a piece of DNA carrying only gene of interest which is transferred into an alien organism? A. The piece of DNA would be able to multiply itself independently in the progeny cells of the organism.
    B. It may get integrated into the genome of the recipient.
    C. It may multiply and be inherited along with the host DNA.
    D. The alien piece of DNA is not an integral part of chromosome.
    E. It shows ability to replicate. …
  20. Q20How many molecules of ATP and NADPH are required for every molecule of CO fixed in the Calvin cycle?
  21. Q21 In a plant, black seed colour () is dominant over white seed colour (). In order to find out the genotype of the black seed plant, with which of the following genotype will you cross it? …
  22. Q22Lecithin, a small molecular weight organic compound found in living tissues, is an example of:
  23. Q23Match List I with List II: Choose the correct answer from the options given below:
  24. Q24 Tropical regions show greatest level of species richness because: A. Tropical latitudes have remained relatively undisturbed for millions of years, hence more time was available for species diversification.
    B. Tropical environments are more seasonal.
    C. More solar energy is available in tropics.
    D. Constant environments promote niche specialization.
    E. Tropical environments are constant and predictable. …
  25. Q25Match List I with List II: Choose the correct answer from the options given below:
  26. Q26The lactose present in the growth medium of bacteria is transported to the cell by the action of:
  27. Q27 Given below are two statements: Statement I: Chromosomes become gradually visible under light microscope during leptotene stage.
    Statement II: The beginning of diplotene stage is recognized by dissolution of synaptonemal complex. In the light of the above statements, choose the correct answer from the options given below: …
  28. Q28Formation of interfascicular cambium from fully developed parenchyma cells is an example for:
  29. Q29 Given below are two statements: Statement I: Parenchyma is living but collenchyma is dead tissue.
    Statement II: Gymnosperms lack xylem vessels but presence of xylem vessels is the characteristic of angiosperms. In the light of the above statements, choose the correct answer from the options given below: …
  30. Q30 Identify the set of correct statements: A. The flowers of Vallisneria are colourful and produce nectar.
    B. The flowers of waterlily are not pollinated by water.
    C. In most of water-pollinated species, the pollen grains are protected from wetting.
    D. Pollen grains of some hydrophytes are long and ribbon like.
    E. In some hydrophytes, the pollen grains are carried passively inside water. …
  31. Q31Which of the following is an example of actinomorphic flower?
  32. Q32The capacity to generate a whole plant from any cell of the plant is called:
  33. Q33 Given below are two statements: Statement I: Bt toxins are insect group specific and coded by a gene cry IAc.
    Statement II: Bt toxin exists as inactive protoxin in B. thuringiensis. However, after ingestion by the insect the inactive protoxin gets converted into active form due to acidic pH of the insect gut. In the light of the above statements, choose the correct answer from the options given below: …
  34. Q34List of endangered species was released by:
  35. Q35The cofactor of the enzyme carboxypeptidase is:
  36. Q36Match List I with List II: Choose the correct answer from the option given below:
  37. Q37Which of the following statement is correct regarding the process of replication in E. coli?
  38. Q38Match List I with List II: Choose the correct answer from the options given below:
  39. Q39Identify the correct description about the given figure:
  40. Q40Identify the step in tricarboxylic acid cycle, which does not involve oxidation of substrate.
  41. Q41 Given below are two statements: Statement I: In C plants, some O
  42. Q42 In an ecosystem if the Net Primary Productivity (NPP) of first trophic level is (kcal m) yr
  43. Q43Match List I with List II: Choose the correct answer from the options given below:
  44. Q44Match List I with List II: Choose the correct answer from the options given below:
  45. Q45The DNA present in chloroplast is:
  46. Q46Spraying sugarcane crop with which of the following plant growth regulators, increases the length of stem, thus, increasing the yield?
  47. Q47 Read the following statements and choose the set of correct statements: In the members of Phaeophyceae: A. Asexual reproduction occurs usually by biflagellate zoospores.
    B. Sexual reproduction is by oogamous method only.
    C. Stored food is in the form of carbohydrates which is either mannitol or laminarin.
    D. The major pigments found are chlorophyll a, c and carotenoids and xanthophyll.
    E. Vegetative cells have a cellulosic wall, usually covered on the outside by gelatinous coating of algin. …
  48. Q48Which of the following are fused in somatic hybridization involving two varieties of plants?
  49. Q49Match List I with List II: Choose the correct answer from the options given below:
  50. Q50Match List I with List II: Choose the correct answer from the options given below:
  51. Q51Match List I with List II: Choose the correct answer from the options given below:
  52. Q52The flippers of the penguins and dolphins are the example of the:
  53. Q53 Given below are some stages of human evolution. Arrange them in correct sequence (Past to recent). A. Homo habilis
    B. Homo sapiens
    C. Homo neanderthalensis
    D. Homo erectus …
  54. Q54Which one of the following factors will not affect the Hardy-Weinberg equilibrium?
  55. Q55Which of the following factors are favourable for the formation of oxyhaemoglobin in alveoli?
  56. Q56Which of the following is not a natural/traditional contraceptive method?
  57. Q57Match List I with List II: Choose the correct answer from the options given below:
  58. Q58 Given below are two statements: Statement I: The presence or absence of hymen is not a reliable indicator of virginity.
    Statement II: The hymen is torn during the first coitus only. In the light of the above statements, choose the correct answer from the options given below: …
  59. Q59Match List I with List II: Choose the correct answer from the options given below:
  60. Q60Match List I with List II: Choose the correct answer from the options given below:
  61. Q61 Given below are two statements: Statement I: In the nephron, the descending limb of loop of Henle is impermeable to water and permeable to electrolytes.
    Statement II: The proximal convoluted tubule is lined by simple columnar brush border epithelium and increases the surface area for reabsorption. In the light of the above statements, choose the correct answer from the options given below: …
  62. Q62Match List I with List II: Choose the correct answer from the option given below:
  63. Q63Match List I with List II: Choose the correct answer from the options given below:
  64. Q64 Consider the following statements: A. Annelids are true coelomates
    B. Poriferans are pseudocoelomates
    C. Aschelminthes are acoelomates
    D. Platyhelminthes are pseudocoelomates Choose the correct answer from the options given below: …
  65. Q65Match List I with List II: Choose the correct answer from the options given below:
  66. Q66 Following are the stages of pathway for conduction of an action potential through the heart: A. AV bundle
    B. Purkinje fibres
    C. AV node
    D. Bundle branches
    E. SA node Choose the correct sequence of pathway from the options given below: …
  67. Q67Match List I with List II: Choose the correct answer from the options given below:
  68. Q68The following diagram showing restriction sites in E. coli cloning vector pBR322. Find the role of 'X' and 'Y' genes:
  69. Q69The 'Ti plasmid' of Agrobacterium tumefaciens stands for:
  70. Q70Match List I with List II: Choose the correct answer from the options given below:
  71. Q71Which of the following statements is incorrect?
  72. Q72Which one is the correct product of DNA dependent RNA polymerase to the given template? 3' TACATGGCAAATATCCATTCA 5'
  73. Q73Match List I with List II: Choose the correct answer from the options given below:
  74. Q74Match List I with List II: Choose the correct answer from the options given below:
  75. Q75In both sexes of cockroach, a pair of jointed filamentous structures called anal cerci are present on:
  76. Q76 Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R: Assertion A: Breast-feeding during initial period of infant growth is recommended by doctors for bringing a healthy baby.
    Reason R: Colostrum contains several antibodies absolutely essential to develop resistance for the new born baby. In the light of the above statements, choose the most appropriate answer from the options given below: …
  77. Q77Match List I with List II: Choose the correct answer from the options given below:
  78. Q78Three types of muscles are given as a, b and c. Identify the correct matching pair along with their location in human body:
  79. Q79Which of the following is not a steroid hormone?
  80. Q80Match List I with List II: Choose the correct answer from the options given below:
  81. Q81 Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R: Assertion A: FSH acts upon ovarian follicles in female and Leydig cells in male.
    Reason R: Growing ovarian follicles secrete estrogen in female while interstitial cells secrete androgen in male human being. In the light of the above statements, choose the correct answer from the options given below: …
  82. Q82Match List I with List II: Choose the correct answer from the options given below:
  83. Q83 Following are the stages of cell division: A. Gap 2 phase  B. Cytokinesis
    C. Synthesis phase  D. Karyokinesis
    E. Gap 1 phase Choose the correct sequence of stages from the options given below: …
  84. Q84 Which of the following are Autoimmune disorders? A. Myasthenia gravis
    B. Rheumatoid arthritis
    C. Gout
    D. Muscular dystrophy
    E. Systemic Lupus Erythematosus (SLE) …
  85. Q85Match List I with List II: Choose the correct answer from the options given below:
  86. Q86 Given below are two statements: Statement I: The cerebral hemispheres are connected by nerve tract known as corpus callosum.
    Statement II: The brain stem consists of the medulla oblongata, pons and cerebrum. In the light of the above statements, choose the most appropriate answer from the options given below: …
  87. Q87Match List I with List II: Choose the correct answer from the options given below:
  88. Q88Match List I with List II: Choose the correct answer from the options given below:
  89. Q89Match List I with List II: Choose the correct answer from the options given below:
  90. Q90Match List I with List II: Choose the correct answer from the options given below:

Attempt this as a full mock test

Timed paper, instant score, all-India rank prediction on Fundamenthol.

Take this mock test →